All About Sample Submission for DNA Services
The MRCF will accept samples at any stage in sample preparation. We will accept whole tissue for nucleic acid extraction, PCR amplified products and even researcher-prepared library constructs to run on our MiSeq. We routinely accept already extracted and prepared DNA to be processed on our Sanger DNA sequencer. Below is information about how to prepare and ship samples to the MRCF for any of our services.
Our lab is located in the Gale Life Sciences Building near Holt Arena; we are on the 4th floor in room 461. The physical address of our building is 650 Memorial Drive, Pocatello ID 83209. Here is a downloadable campus Map to the MRCF.
If you have any additional questions please don't hesitate to contact us by phone, (208) 282-4148, or email mrcf@isu.edu.
New MRCF User
If you have never submitted samples to the MRCF before, there is a one-time form that you are required to fill-out. On this form, you and your PI or Lab Director will provide contact information about your lab and samples information to ensure our staff's safety while handling your samples.
Job Request Form
The Job Request Form is a form that contains information about the samples you are sending us - i.e. Sample names and what kind of samples we are processing. For more information on how to prepare your samples, checkout the section below "Sample Concentration and Primers."
Input DNA for Sequencing
Starting with the correct concentration of template DNA is critical to every molecular application. Below is the nanogram amount of DNA needed for different types of DNA sequencing services we provide.
Available Primers
We provide the following primers for Sanger DNA sequencing, Next-Generation Sequencing and typical Polymerase Chain Reaction (PCR).
If you would like us to add these to your samples, it must be specified on the Job Request Form.
PRIMER | SEQUENCE | APPLICATION |
---|---|---|
M13F(-20) | GTAAAACGACGGCCAGT | Sanger Sequencing, PCR |
M13R | CAGGAAACAGCTATGAC | Sanger Sequencing, PCR |
M13F(-40) | GTTTTCCCAGTCACGAC | Sanger Sequencing, PCR |
M13R(-48) | AGCGGATAACAATTTCACA | Sanger Sequencing, PCR |
T7 | TAATACGACTCACTATAGGG | Sanger Sequencing, PCR |
T3 | ATTAACCCTCACTAAAGGG | Sanger Sequencing, PCR |
SP6 | TATTTAGGTGACACTATAG | Sanger Sequencing, PCR |
SP6R | TATAGTGTCACCTAAAT | Sanger Sequencing, PCR |
T7R | TATAGTGAGTCGTATTA | Sanger Sequencing, PCR |
T7 Term. | GCTAGTTATTGCTCAGCGG | Sanger Sequencing, PCR |
8F | AGAGTTTGATCCTGGCTCAG | Sanger Sequencing, PCR |
907R | CCGTCAATTCCTTTRAGTTT | Sanger Sequencing, PCR |
704F | GTAGCGGTGAAATGCGTAGA | Sanger Sequencing, PCR |
1492R | GGTTACCTTGTTACGACTT | Sanger Sequencing, PCR |
PUC Univ. | GGCTGGCTTAACTAT | Sanger Sequencing, PCR |
V3-V4 For. | CGTCGGCAGCGTCAGATGTGTATAA GAGACAGCCTACGGGNGGCWGCAG | NGS 16S Metagenomic Amplicons |
V3-V4 Rev. | GTCTCGTGGGCTCGGAGATGTGTATAAG AGACAGGACTACHVGGGTATCTAATCC | NGS 16S Metagenomic Amplicons |
V4 For. | TCGTCGGCAGCGTCAGATGTGTATAAGA GACAGGTGYCAGCMGCCGCGGTAA | NGS 16S Metagenomic Amplicons |
V4 Rev. | GTCTCGTGGGCTCGGAGATGTGTATAAG AGACAGGGACTACNVGGGTWTCTAAT | NGS 16S Metagenomic Amplicons |
Tubes:
Samples can arrive in strip-tubes, microcentrifuge tubes or other properly sealed tube. We ask that the tubes be wrapped in Paraffin to prevent any lids opening and evaporation.
Small tubes, such as PCR tubes, have arrived crushed in the mail. If you are sending small tubes, please secure them in something larger - either place them in a 50mL conical tube, or some sort of rack, to prevent damage from the shipping and handling.
Labeling:
Clearly label your samples. If samples are in strip-tubes, mark the correct orientation by placing an "A1" or "1" to show which is the first sample in the strip. If samples are in a plate, make sure the plate is marked so we know typical A1-H12 orientation was followed.
If sending primers, makes sure the primer concentration is clear. We can dilute primers to the correct concentration if we know what the concentration is for the primer sent to our lab.
Temperature:
DNA for Sanger sequencing and Fragment Analysis can be shipped at room temperature (ambient) if the samples will arrive within a day or two. If delays are expected, please pack with ice packs to prevent the samples from getting too hot. DNA libraries for NGS should be sent on ice to prevent adapter degradation.
RNA needs to be kept frozen. Overnight shipping on dry ice is preferred, however, if you are certain your samples are not contaminated with RNAses, shipping on ice is an option.
To mail samples to the MRCF for sequencing or other analysis, please ship to:
Idaho State University
Molecular Research Core Facility
Gale Life Sciences Building
650 Memorial Drive Mail Stop 8007
Pocatello, ID 83209-8007
Please email an electronic copy of your Job Request Form to mrcf@isu.edu and include a hard copy of the form along with the shipped samples.
Downloading Data
Once your data has been generated, the raw data files will be uploaded to BOX. You do not need to have a BOX account to access your data. We will email a link to the folder containing your files once the data has been finalized.
Viewing Data
There are freeware software packages that can be downloaded for data viewing:
- Sequence Scanner for Sanger Sequencing data files
- Peak Scanner for Fragment Analysis data files
The MRCF also has an in-house computer with software installed to analyze sequence and fragment analysis data: Sequencher, for sequencing data and GeneMapper v5.0, for fragment analysis data. Analyzing your data sets on our in-house computer is free of charge.
Data Retention Policy
Data will only be saved for 1 year and will not be archived. Please back-up your data immediately.