Molecular Research Core Facility

Sample Submission

NEW: Next - Generation Sequencing Job Request Form

NOW ACCEPTING PAYMENTS VIA CREDIT CARD
NEW: GALAXY DATA MANAGEMENT SYSTEM

1) Fill out a hard copy of the Job Request Form and drop in our Job Request drop box when placing your samples in the MRCF sample freezer. External users please see instructions below under Shipping. If you need assistance filling out the Job Request Form, follow the steps described in our Submitting Orders document.

New to Submitting Samples?

If you have not previously submitted samples, please download and fill out our mandatory Safety Form and Registration Form, and email completed documents to mrcf@isu.edu. These forms provide vital information on the types of samples you will be submitting.

2) Email an electronic version of the Job Request Form to mrcf@isu.edu.

We will process your samples as soon as possible. If this is a rush order, please let us know.

If you have questions about sample preparation and/or shipping, feel free to call us at either (208) 282-4148 or (208) 282-4890.

Please do not use adhesive plate seals on 96-well plates due to the potential for sample cross contamination. Refer to our Submitting Orders information document for recommendations and further information.

Shipping

To mail samples to the MRCF for sequencing or other analysis, please ship to:

Idaho State University
Molecular Research Core Facility
Gale Life Sciences Building
650 Memorial Drive Mail Stop 8007
Pocatello, ID 83209-8007

Data Viewing and Analysis

Download the free sequence trace viewer and editor from Applied Biosystems. You may also download the freeware version of FinchTV from the Geospiza website. In addition, Sequencher software from Gene Codes Corporation is installed on a Macintosh computer in the MRCF for sequence data analysis, and Gene Mapper software is installed on a computer for Fragment Analysis. If you are an off-campus researcher, download the free Peak Scanner software from Applied Biosystems to view and analyze your Fragment Analysis files.

Universal Primers

We provide the following universal primers for DNA sequencing. These can be added to your sample at no additional charge; however, requested addition of these primers needs to be made clear on the Job Request Form.

Primer Primer sequence (5'--3')
M13F (-40) GTTTTCCCAGTCACGAC
M13R CAGGAAACAGCTATGAC
T7 TAATACGACTCACTATAGGG
T3 ATTAACCCTCACTAAAGGG
SP6 TATTTAGGTGACACTATAG
SP6R TATAGTGTCACCTAAAT
T7R TATAGTGAGTCGTATTA
T7 Terminal GCTAGTTATTGCTCAGCGG
8F AGAGTTTGATCCTGGCTCAG
907R CCGTCAATTCCTTTRAGTTT (R=A or G)
704F GTAGCGGTGAAATGCGTAGA
1492R GGTTACCTTGTTACGACTT
M13F (-20) GTAAAACGACGGCCAGT
M13R (-48) AGCGGATAACAATTTCACA
PUC Universal GGCTGGCTTAACTAT

  • Idaho State University • 921 South 8th Avenue • Pocatello, Idaho, USA 83209
  • About ISU
  • Contact ISU